WBO 12 – Mapowanie odczytów NGS

Dziś mamy zajęcia o mapowaniu odczytów. Wykład tutaj: wyk12-ngs

Zadania na dziś dotyczą głównie indeksów sekwencji:

1. Napisz funkcję compute BWT(txt), która oblicza BWT (w postaci napisu) dla zadanej sekwencji DNA oraz tablice C(x) i OCC(i,x)

2. Wylicz te wartośći dla sekwencji:
CGAGCCGCTTTCCATATCTATTAACGCATAAAAAACTCTGCTGGCATTCACAAATGCGCAGGGGTAAAACGTTTCCTGTAGCACCGTGAGTTATACTTTGT

3. Korzystając z metody podanej na wykładzie wyszukaj wystąpień napisu AAAC w podanej sekwencji

4. Korzystając z podanej metody omijania błędów znajdź sekwencję (z co najwyżej jednym błędem) AAAACTCCGCTGGCATTCACAAAT

Zadanie domowe: Użyj stworzonego dziś kodu aby wyszukać wszystkich promotorów z pliku ecoli_proms.fa w sekwencji genomu E. coli Escherichia_coli_str_k_12_substr_mg1655.ASM584v2.dna.chromosome.Chromosome.fa

Leave a Reply

Your email address will not be published. Required fields are marked *

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>